Haplogroup LT (L298/P326) is also known as Haplogroup K1. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. and JavaScript. The G-M286 subclade (M286+) is small compared with G-L91. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Am J Hum Genet 2004; 74: 788788. Google Scholar. The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. Am J Hum Genet 2004; 74: 10231034. volume20,pages 12751282 (2012)Cite this article. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. Correspondence to The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. [2][37], Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP.[2]. G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. Hg G also occurs at frequencies ranging from 5 to 15% in both the rest of Near/Middle East and southern European countries (especially Italy and Greece), with a decreasing frequency gradient towards the Balkans and northern Europe. To obtain Please help update this article to reflect recent events or newly available information. ISSN 1018-4813 (print), Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus, Subdividing Y-chromosome haplogroup R1a1 reveals Norse Viking dispersal lineages in Britain, Phylogenetic analysis of the Y-chromosome haplogroup C2b-F1067, a dominant paternal lineage in Eastern Eurasia, Y-chromosomal connection between Hungarians and geographically distant populations of the Ural Mountain region and West Siberia, Origin and diffusion of human Y chromosome haplogroup J1-M267, Bidirectional dispersals during the peopling of the North American Arctic, The role of matrilineality in shaping patterns of Y chromosome and mtDNA sequence variation in southwestern Angola, Ancient human mitochondrial genomes from Bronze Age Bulgaria: new insights into the genetic history of Thracians, Medieval Super-Grandfather founder of Western Kazakh Clans from Haplogroup C2a1a2-M48, Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians, http://harpending.humanevo.utah.edu/popstr/, Population genetic study of 17 Y-STR Loci of the Sorani Kurds in the Province of Sulaymaniyah, Iraq, Phylogenetic history of patrilineages rare in northern and eastern Europe from large-scale re-sequencing of human Y-chromosomes, Sex-biased patterns shaped the genetic history of Roma, Middle eastern genetic legacy in the paternal and maternal gene pools of Chuetas, Cancel This is achieved by comparing the haplotypes through the STR markers. Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. Then we applied a 10% overall hg G frequency threshold and the additional specification that both haplogroup G1 and G2 lineages also be present. Moreover, these general frequencies mostly consist of two notable lineages. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. Science 2000; 290: 11551159. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. The frequency data were converted into isofrequency maps using the Surfer software (version 8, Golden Software, Inc., Golden, CO, USA), following the kriging algorithm using advanced options to use bodies of waters as breaklines. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. The mutations involved may be complicated and difficult to interpret. Ann Hum Genet 2008; 72: 205214. Lacan M, Keyser C, Ricaut FX et al. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. It is a branch of haplogroup G (Y-DNA) (M201). [29][30][31] 3% of North African Berbers were found to be haplogroup G.[32] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[33]. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. [citation needed] Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. [24] Haplogroup G-M201 is believed to have been relatively absent during Neolithic India; the frequencies of the G2a-P15 subclade for example was negligible in indigenous Indian populations. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. [43] L240 was identified in 2009. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. There are additional subclades of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. Am J Hum Genet 2004; 74: 694704. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. However, interpretations based on coarse haplogroup resolution frequency clines are unsophisticated and do not recognize underlying patterns of genetic diversification. Yunusbayev B, Metspalu M, Jrve M et al. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. Ann Hum Genet 2005; 69: 443454. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Luis JR, Rowold DJ, Regueiro M et al. The number of STR marker values separating men in this group suggest G-PF3359 is a relatively old group despite the small number of men involved. Princeton: Princeton University Press, 1994. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. Genetic evidence concerning the origins of South and North Ossetians. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. . The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The hg G-U1 subclade is characterized by several sub-clusters of haplotypes, including a more diverse cluster mostly represented by Caucasus populations. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. Nei M : Molecular Evolutionary Genetics. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. Internet Explorer). Haplogroup P (P295) is also klnown as K2b2. (a) Principal component analysis by population. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). Mol Biol Evol 2006; 23: 22682270. The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4. Mol Phylogenet Evol 2007; 44: 228239. Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. Several G-PF3359 subclades, based on shared STR markers, probably exist. The haplogroups contain many branches called subhaplogroups or subclades. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. The presence of M527 in Provence, southern Italy and Ukraine may reflect subsequent Greek maritime Iron Age colonization events16 and perhaps, given its appearance among the Druze and Palestinians, even episodes associated with the enigmatic marauding Sea Peoples.42. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. The L141 mutation is found on the Y chromosome at 2948607. Haplogroup H Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. The P303 SNP defines the most frequent and widespread G sub-haplogroup. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. PubMedGoogle Scholar. The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). PLoS One 2011; 6: e20232. The overall coalescent age estimate (Supplementary Table S4) for P303 is 12600 years ago. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. Men who belong to this group but are negative for all its subclades represent a small number today. [41] These classifications are based on shared SNP mutations. PLoS One 2011; 6: e17548. On this Wikipedia the language links are at the top of the page across from the article title. The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions.
Are Self Defense Keychains Legal In Washington State,
4 Corner Hustlers Rappers,
Tyson Fury Team Members,
Articles H
